ID: 1000825053_1000825060

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1000825053 1000825060
Species Human (GRCh38) Human (GRCh38)
Location 5:166034712-166034734 5:166034744-166034766
Sequence CCAGGTTCCAGCTGGGCACCGTG TATAATCCCAGAACTCTGGGAGG
Strand - +
Off-target summary No data {0: 27, 1: 1768, 2: 44282, 3: 347997, 4: 251957}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!