ID: 1001003178_1001003181

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1001003178 1001003181
Species Human (GRCh38) Human (GRCh38)
Location 5:168026949-168026971 5:168026965-168026987
Sequence CCTCCCAATTTCTACATGAAATA TGAAATAAGAATATCAAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 315} {0: 1, 1: 1, 2: 7, 3: 66, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!