ID: 1001016695_1001016696

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1001016695 1001016696
Species Human (GRCh38) Human (GRCh38)
Location 5:168148291-168148313 5:168148305-168148327
Sequence CCTAAGGGCACACTCATTATGCA CATTATGCAAAATTGAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103} {0: 1, 1: 0, 2: 1, 3: 28, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!