ID: 1001017971_1001017975

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1001017971 1001017975
Species Human (GRCh38) Human (GRCh38)
Location 5:168158635-168158657 5:168158654-168158676
Sequence CCCTCCTCAAATTGTGACAATCA ATCAAAAATGTCTCCAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 313} {0: 1, 1: 14, 2: 51, 3: 113, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!