ID: 1001035322_1001035339

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001035322 1001035339
Species Human (GRCh38) Human (GRCh38)
Location 5:168292568-168292590 5:168292588-168292610
Sequence CCCGCCCGCCCCCTTTAGGAAGA AGAGAGGTCGGGCGGGGGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 68, 4: 609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!