ID: 1001040692_1001040699

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1001040692 1001040699
Species Human (GRCh38) Human (GRCh38)
Location 5:168333041-168333063 5:168333069-168333091
Sequence CCCTTCAAGTCTCAAGCCCCACC CCTCCTGACTTCAGCATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 157} {0: 1, 1: 0, 2: 0, 3: 33, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!