ID: 1001040692_1001040705

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1001040692 1001040705
Species Human (GRCh38) Human (GRCh38)
Location 5:168333041-168333063 5:168333091-168333113
Sequence CCCTTCAAGTCTCAAGCCCCACC GGGATGGCACCCCCGGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 157} {0: 1, 1: 0, 2: 1, 3: 19, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!