ID: 1001048548_1001048559

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1001048548 1001048559
Species Human (GRCh38) Human (GRCh38)
Location 5:168395220-168395242 5:168395254-168395276
Sequence CCCACAGTACAGACCCATGTCCA TGATGAACAGGGTGGTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115} {0: 1, 1: 0, 2: 1, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!