ID: 1001080723_1001080732

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001080723 1001080732
Species Human (GRCh38) Human (GRCh38)
Location 5:168665412-168665434 5:168665460-168665482
Sequence CCAGCCTTCCGCTTCCAAGAAGG CATTCCAATGAAAAATTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 205} {0: 1, 1: 0, 2: 2, 3: 25, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!