ID: 1001086693_1001086699

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001086693 1001086699
Species Human (GRCh38) Human (GRCh38)
Location 5:168705168-168705190 5:168705216-168705238
Sequence CCTGCAATCACTGCACTTGCCAA GCACAGCTTCTAGAGTCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 216} {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!