ID: 1001096540_1001096548

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1001096540 1001096548
Species Human (GRCh38) Human (GRCh38)
Location 5:168779814-168779836 5:168779842-168779864
Sequence CCAGCTTCTTTCATTTGGGGTCC ACATGGGGAGATGGCCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 172} {0: 1, 1: 0, 2: 6, 3: 16, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!