ID: 1001100647_1001100652

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1001100647 1001100652
Species Human (GRCh38) Human (GRCh38)
Location 5:168811008-168811030 5:168811023-168811045
Sequence CCAGCCACATTGTTCTTCTCCTA TTCTCCTAAATGGTAAAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 329} {0: 1, 1: 0, 2: 2, 3: 36, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!