ID: 1001106337_1001106342

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1001106337 1001106342
Species Human (GRCh38) Human (GRCh38)
Location 5:168857850-168857872 5:168857876-168857898
Sequence CCCTCAACGGTGTGCCTATCAGG AGATTCACGTAGGAGTTCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!