ID: 1001108278_1001108281

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1001108278 1001108281
Species Human (GRCh38) Human (GRCh38)
Location 5:168874406-168874428 5:168874457-168874479
Sequence CCTTCGCTTATTGTTTATTGAGC TAAAAACAGAACAATGAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 159, 4: 2071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!