ID: 1001110444_1001110453

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1001110444 1001110453
Species Human (GRCh38) Human (GRCh38)
Location 5:168891638-168891660 5:168891677-168891699
Sequence CCAAGCACTATGGAGATAAGATG CATTCTGACCAAAGGGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 136} {0: 1, 1: 0, 2: 1, 3: 25, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!