ID: 1001149091_1001149097

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1001149091 1001149097
Species Human (GRCh38) Human (GRCh38)
Location 5:169211215-169211237 5:169211253-169211275
Sequence CCGCTGAGATTCTGAGGTTGTCT CTGAGTAATGCAGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 16, 3: 84, 4: 436} {0: 1, 1: 0, 2: 2, 3: 26, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!