ID: 1001158811_1001158819

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1001158811 1001158819
Species Human (GRCh38) Human (GRCh38)
Location 5:169296513-169296535 5:169296557-169296579
Sequence CCGTGGTTGACCCAGAGAGACCC TGTCCTCTAAGCTGGCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 506} {0: 1, 1: 0, 2: 1, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!