ID: 1001174843_1001174854

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1001174843 1001174854
Species Human (GRCh38) Human (GRCh38)
Location 5:169458701-169458723 5:169458740-169458762
Sequence CCCTTATCGCCAGGGAACTGAGG CTGTAGTTTTTCAGGGGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!