ID: 1001181640_1001181653

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1001181640 1001181653
Species Human (GRCh38) Human (GRCh38)
Location 5:169526081-169526103 5:169526125-169526147
Sequence CCCTATGTGGGGGATCCGACCCC CTAGCACAGGTTCTCCATGAGGG
Strand - +
Off-target summary No data {0: 16, 1: 1111, 2: 1516, 3: 1250, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!