|
Left Crispr |
Right Crispr |
Crispr ID |
1001181643 |
1001181653 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:169526100-169526122
|
5:169526125-169526147
|
Sequence |
CCCCACATTTCCCTTCCACATTG |
CTAGCACAGGTTCTCCATGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 37, 1: 472, 2: 797, 3: 1422, 4: 1798} |
{0: 16, 1: 1111, 2: 1516, 3: 1250, 4: 912} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|