ID: 1001181646_1001181652

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1001181646 1001181652
Species Human (GRCh38) Human (GRCh38)
Location 5:169526110-169526132 5:169526124-169526146
Sequence CCCTTCCACATTGCCCTAGCACA CCTAGCACAGGTTCTCCATGAGG
Strand - +
Off-target summary No data {0: 20, 1: 1107, 2: 1623, 3: 1385, 4: 1078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!