ID: 1001181649_1001181657

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1001181649 1001181657
Species Human (GRCh38) Human (GRCh38)
Location 5:169526115-169526137 5:169526154-169526176
Sequence CCACATTGCCCTAGCACAGGTTC CCCTGTAGCAAACTTTTGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 25, 2: 373, 3: 1287, 4: 1770}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!