ID: 1001206255_1001206258

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1001206255 1001206258
Species Human (GRCh38) Human (GRCh38)
Location 5:169765984-169766006 5:169766006-169766028
Sequence CCTATATCTTTTCTAATCAACAT TATCATTGCAGCATTGGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 383} {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!