ID: 1001207755_1001207763

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1001207755 1001207763
Species Human (GRCh38) Human (GRCh38)
Location 5:169779937-169779959 5:169779981-169780003
Sequence CCGTTGCATTTGCCCTCCCAGAG TCTGGGTCACCGAAGCAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 231} {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!