|
Left Crispr |
Right Crispr |
| Crispr ID |
1001212081 |
1001212084 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:169819447-169819469
|
5:169819463-169819485
|
| Sequence |
CCTACACCTACAAAAAATTAAAA |
ATTAAAAAATTAGCTGGTCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 96, 3: 1298, 4: 8442} |
{0: 8, 1: 334, 2: 3578, 3: 44207, 4: 105518} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|