|
Left Crispr |
Right Crispr |
| Crispr ID |
1001212082 |
1001212085 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:169819453-169819475
|
5:169819485-169819507
|
| Sequence |
CCTACAAAAAATTAAAAAATTAG |
GTAGCATGCACCTGTAGTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 25, 1: 123, 2: 571, 3: 3641, 4: 5808} |
{0: 6, 1: 91, 2: 351, 3: 999, 4: 2183} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|