ID: 1001225041_1001225051

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1001225041 1001225051
Species Human (GRCh38) Human (GRCh38)
Location 5:169936947-169936969 5:169936994-169937016
Sequence CCCAGACTGGGTTTCCCACCACC TGGTAGCTTGAACACTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 175} {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!