ID: 1001226290_1001226300

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1001226290 1001226300
Species Human (GRCh38) Human (GRCh38)
Location 5:169947280-169947302 5:169947324-169947346
Sequence CCAAGATTGTGAAGAGGAGATGG TTTTCCAAGGGGAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 205} {0: 1, 1: 0, 2: 3, 3: 32, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!