ID: 1001233418_1001233423

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1001233418 1001233423
Species Human (GRCh38) Human (GRCh38)
Location 5:170009475-170009497 5:170009502-170009524
Sequence CCTTGCTCATGTCCTGAATCCTC ATAAATATGTGCTGAAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 809} {0: 1, 1: 1, 2: 9, 3: 95, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!