ID: 1001246473_1001246481

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1001246473 1001246481
Species Human (GRCh38) Human (GRCh38)
Location 5:170108691-170108713 5:170108738-170108760
Sequence CCATGACTGCGGAACTGCCCAGA CCACCCTCTTTCTAGAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110} {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!