ID: 1001286995_1001286998

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1001286995 1001286998
Species Human (GRCh38) Human (GRCh38)
Location 5:170431044-170431066 5:170431075-170431097
Sequence CCTCACTCCATCTGCAGATGCTG CATTCCAGCCCTCGCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 348} {0: 1, 1: 1, 2: 1, 3: 29, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!