ID: 1001287950_1001287958

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1001287950 1001287958
Species Human (GRCh38) Human (GRCh38)
Location 5:170437464-170437486 5:170437515-170437537
Sequence CCTTCAAATCTCTGCTCACCCCC ACATGAAGCAACCTTCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 325} {0: 1, 1: 0, 2: 2, 3: 13, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!