ID: 1001289606_1001289614

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001289606 1001289614
Species Human (GRCh38) Human (GRCh38)
Location 5:170447465-170447487 5:170447513-170447535
Sequence CCCTAGAGTTTGAATGGGAAGTT CAGGACCCCGTTTGTGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!