ID: 1001293585_1001293589

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1001293585 1001293589
Species Human (GRCh38) Human (GRCh38)
Location 5:170483616-170483638 5:170483633-170483655
Sequence CCCCCACTCATCTTTACAGCTGT AGCTGTATCCTGCAAGTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209} {0: 1, 1: 0, 2: 3, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!