ID: 1001304292_1001304309

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1001304292 1001304309
Species Human (GRCh38) Human (GRCh38)
Location 5:170560533-170560555 5:170560580-170560602
Sequence CCCTGTCACACAGCAGTGTTGTG GGTCCTTTCTTGGTGGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!