ID: 1001304292_1001304311

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1001304292 1001304311
Species Human (GRCh38) Human (GRCh38)
Location 5:170560533-170560555 5:170560582-170560604
Sequence CCCTGTCACACAGCAGTGTTGTG TCCTTTCTTGGTGGTGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 196} {0: 1, 1: 0, 2: 2, 3: 35, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!