ID: 1001304348_1001304356

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1001304348 1001304356
Species Human (GRCh38) Human (GRCh38)
Location 5:170560874-170560896 5:170560899-170560921
Sequence CCTTCTCCTCTCCCACTCCTTCC CCCAGATTCTCCCTCACTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 44, 3: 461, 4: 3259} {0: 1, 1: 0, 2: 1, 3: 7, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!