ID: 1001317167_1001317173

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001317167 1001317173
Species Human (GRCh38) Human (GRCh38)
Location 5:170652007-170652029 5:170652055-170652077
Sequence CCACCAGGAAGTTACTCGGCAAA CTGAGCAATGAGGAGCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} {0: 1, 1: 0, 2: 5, 3: 41, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!