ID: 1001345753_1001345762

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1001345753 1001345762
Species Human (GRCh38) Human (GRCh38)
Location 5:170896908-170896930 5:170896956-170896978
Sequence CCCAGCTGACTATGCACCAGAAT GGCCAGTGCGAAAACCAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 1, 2: 5, 3: 24, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!