ID: 1001357419_1001357422 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1001357419 | 1001357422 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:171042345-171042367 | 5:171042368-171042390 |
| Sequence | CCTAACCATATGATAGGAATTTT | TCAACTCCATGTAATCCTAAGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 3, 3: 27, 4: 298} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||