ID: 1001377816_1001377818

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001377816 1001377818
Species Human (GRCh38) Human (GRCh38)
Location 5:171279463-171279485 5:171279483-171279505
Sequence CCAAACTCAACCTTTTTATAAAG AAGAACCAATCCCAGAATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 417} {0: 1, 1: 0, 2: 0, 3: 23, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!