ID: 1001381653_1001381657

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1001381653 1001381657
Species Human (GRCh38) Human (GRCh38)
Location 5:171309916-171309938 5:171309934-171309956
Sequence CCGGGCAGCCGTGGTGGGGAGGG GAGGGTAATCGGAGAGTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 55, 4: 487} {0: 1, 1: 0, 2: 0, 3: 8, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!