ID: 1001381903_1001381916

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1001381903 1001381916
Species Human (GRCh38) Human (GRCh38)
Location 5:171311028-171311050 5:171311059-171311081
Sequence CCCGCGGACCCCAGCGACCCCGG GGGCCAAGTCAGTTACACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 196} {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!