ID: 1001382885_1001382901

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1001382885 1001382901
Species Human (GRCh38) Human (GRCh38)
Location 5:171315550-171315572 5:171315603-171315625
Sequence CCGGTCCGGGCAGGGAGTGAGGC GCGGGTAGGGTATGGGACTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!