ID: 1001435705_1001435706

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1001435705 1001435706
Species Human (GRCh38) Human (GRCh38)
Location 5:171697629-171697651 5:171697644-171697666
Sequence CCAGGCAGGCTTATGAGGGGCTG AGGGGCTGAGAACAAGCAGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!