ID: 1001466894_1001466896

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1001466894 1001466896
Species Human (GRCh38) Human (GRCh38)
Location 5:171975365-171975387 5:171975382-171975404
Sequence CCAAATGCAGAGAATCTGCTGCT GCTGCTGGCCAGCCACAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 34, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!