ID: 1001491643_1001491652

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1001491643 1001491652
Species Human (GRCh38) Human (GRCh38)
Location 5:172160175-172160197 5:172160212-172160234
Sequence CCTACAAAATGGCCCCTAGCCAG GCCTGTAATCCCAGCATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 109} {0: 9429, 1: 235524, 2: 277870, 3: 222838, 4: 263838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!