ID: 1001501736_1001501741 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1001501736 | 1001501741 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:172241990-172242012 | 5:172242025-172242047 |
| Sequence | CCTGGGCAACAGAGGAAGACCCT | GGTGCCCTTCCCATGAGATCTGG |
| Strand | - | + |
| Off-target summary | {0: 74, 1: 4822, 2: 27881, 3: 88195, 4: 176046} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||