ID: 1001506378_1001506387

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1001506378 1001506387
Species Human (GRCh38) Human (GRCh38)
Location 5:172283734-172283756 5:172283771-172283793
Sequence CCTCCTCCGGCGCCACCGCCGAG GCCGCTCCGCTCGCCCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 563} {0: 1, 1: 0, 2: 2, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!