ID: 1001530642_1001530647

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1001530642 1001530647
Species Human (GRCh38) Human (GRCh38)
Location 5:172459123-172459145 5:172459140-172459162
Sequence CCCAGCTGCCACTGTGCCTTGTC CTTGTCCCAGCTGTCATTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 264} {0: 1, 1: 0, 2: 5, 3: 23, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!